I'm in love!

Step 1: Meet girl.
Step 2: Get girl to marry me.
Step 3: Convince girl to let me have this at the wedding.


















Step 4: Live happily ever after.
More geeky cakes here.

Lame Post

Hey, you've been warned.

I'll be busy this week, what with school being nearly finished. Ugh, why do I procrastinate so much? And does anyone feel like hiring a biochemist with 90% of his MS completed? Anyhow, since I won't be able to entertain you this week, here are a few links to keep you occupied while I'm away.

Earth Day, by Done With Mirrors

What the year 2000 looked like from 1900, by Paleo-Future

Jason Lee Storts on Spong.

Zombie killing? Why yes, I believe you should.

And of course, if you really need some entertainment, there's always Fark.

Nuts to Earth: Why I Hate Public Transit

I've been pondering this post for a while, and now seemed like an appropriate time.

Don't mistake me, I see plenty of value in mass transit, especially since it helps me save lots of money for getting to school. But there are a lot of aspects of it that just grate on my nerves. In no particular order:

• The Smells

There's always something. If it isn't just the general reek of BO from trapping a bunch of people into a small space on a warm day, it's the guys who seem to lack hygiene and smell like the bottom of an ash tray. Seriously, these people must cease smoking only to sleep and ride the train.

And why do they always sit next to me? The other attractive women my age will avoid me like a bald plague, but these guys will sit down next to me on an otherwise empty train. No thanks.

• The Disorders

I'm constantly telling my sister, a medical student, that she should just skip her rotations and ride the train with me everyday. She'll see more there than any doctor's office.

It's a little bit of everything. The people with mental disorders are interesting. Most seem harmless if amusing, though I do feel a bit nervous when they talk to themselves. One woman actually carried on a loud, raucous conversation with her, um, "friend." I guess if you're going to hear voices, they may as well be entertaining.

However, the physical maladies are more disturbing. For example, the other day I saw a man with what looked like a horn coming out of his forearm. Black and about the size of a human thumb, I have no idea what it was. Maybe he broke his arm and never had it repaired. I don't know. Still . . . gross.

• The Music

Allowing cell phones to play music was a terrible innovation, especially when combined with speaker phone. There are plenty of jerks (with, wouldn't you know it, terrible taste in music) who feel no shame in sitting there, letting their phones blast out music to the rest of the train, oblivious to the rudeness. Almost as bad are the people who wear headphones but play their music so loudly that I can hear the music coming from their headphones.

This one wouldn't bother me so much except that I usually try to study or grade papers on the train, and trying to concentrate while listening to some guy call out, "Shut up N*gga while I screw this ho or I'll shoot you," (or, well, insert your favorite rap lyrics) tends to be hard. Disruptive to the train of thought and all that jazz.

• The Cardinals

Okay, so I'm normally a baseball fan, but the baseball games are almost always at times when I'm on my way to school (either in the morning or in the evening). This can be frustrating when I have to stand for 20 min. of my ride and I have a lot of books in my bag. I'll be lucky if I don't give myself scoliosis.

However, it's also an opportunity to mourn for the state of common courtesy. The other day when there was a game, I had to stand for lack of seats. A woman came on the train with two young children in tow, and she tried desperately to hold them both while grabbing a rail to keep herself steady. She stood right next to two men who just ignored her. Nobody offered her their seat. I just couldn't believe it. I hope those two men sleep soundly at night.

Like I said, none of these are deal-breakers when it comes to the transit, but it seemed like an opportunity to share some humorous griping. Well, "humorous" as I can provide, at least.

Heroes Returns!

On a brighter note, the new episodes of Heroes returned this evening. I love this show. It's like I'm 10 years old again when I watch.

Sadly, there are only 4 episodes left. Yeesh. Whatever the writers of this show end up working on next, I'm there.

But, this will at least tide me over until the next season of The Dresden Files shows up.

The Current on VT Murders

UMSL's newspaper, The Current, is published weekly on Mondays, so today was the first tack of their editorial board to talk about the murders over at Virginia Tech. I've been unimpressed with The Current's editorial board in the year I've been at UMSL, and this issue pretty much tells me why.

First, we have the general editorial on learning lessons from the tragedy. The major premise here is that there were so many signs, somebody should have done "something" to prevent this. They don't really have any concrete suggestions. Have people "watch out" for each other. Maybe have professors send their students to "certified counselors" to deal with whatever makes them tick (or not).

Professionals had already examined the killer and found there to be no grounds for involuntary commitment to a mental ward. So, at this point, the question should be either, "Did those professionals miss something?" or "Is there something wrong with the rules on these matters?" Maybe involuntary commitment should have more relaxed rules. Maybe there should be more pressure on follow-up with potentially dangerous people. I don't know.

But The Current's suggestion of more counselors and watchful professors is, well, childish. I mean, the latter is reasonable and necessary, but obvious enough that it should go without saying. But more counselors? I don't think that was the problem here, and I doubt it's the right solution.

Ah, but then we have Adam Wiseman, who blames it all on "our murder nation." Yes, you see we are the ones at fault here. President Bush is the one at fault. You know why? Guns. Bad, bad guns. And television. Wicked, sinful television. If the government (evil and corrupt as it is) would just take away the guns and make everything on television happy unicorns and sunshiny rainbows, then life would be better and nobody would ever be able to hurt another person again!

Right?

Yeah. When I said that the previous opinion was childish, it seems like ageless wisdom in comparison to this incoherent ramble.

I hate to be the one to say it, but taking away guns from law abiding citizens won't keep them out of the hands of criminals. And even if you take a gun away from someone, if they want to find a way to hurt someone badly enough, they'll find a way. Boxcutters on an airplane killed people in NYC. Fertilizer on a truck killed people in Oklahoma City. I'm not going to pretend to have answers on how to prevent people from committing such horrible atrocities, but I certainly won't latch onto some infantile view of the world in the hopes that the placebo will make me feel better about it.

Hope in the Midst of Tragedy

I feel like I ought to write something about the shootings at Virginia Tech, but I'm honestly not sure what to say. I've been struggling to gather my thoughts on this since it happened.

I was in high school when the Columbine killings occurred, and this event brings back similar memories and feelings. You don't tend to think of schools as being such dangerous places, but then something like this occurs and you wonder, could it happen at my school? What about my students and classmates?

Of course, it doesn't help that my boneheaded students kept making jokes about the shooter going after his TA because of grades. Timing, fellas. Timing.

The other day I was listening to Ravi Zacharias talk about the problem of evil: Why would a good God allow evil and suffering in this world? Such thoughts are bound to be on the minds of both the families of the victims and their supporters as people deal with this.

I don't have a problem being philosophical about this. While people have been rightly criticized for turning the bodies of dead students into a soap box, I agree with Dafyyd that the best balm for an injured soul is rational thought.

I've always thought about this with the argument that the greatest good is only possible when people are free to choose between good and evil. We know what good is because we can compare it to evil. If people were unable to choose evil, then "good" would be meaningless because it would have no value. The words of a robot programmed to say "I love you" are meaningless because there is no depth to those feelings, only a compulsion lacking a will. When a person chooses to say that, then it is a profession of great significance.

So, I can rationalize why God must allow evil to exist in this world. But why did God allow this act of evil to take place? I have no answer for that. The standard response, though it seems trite staring freshly into the face of tragedy, is that God can work good from anything. Deep down, this feels insufficient. "Good? Good?! Where is the good in this? Thirty-three people are dead because someone snapped and you're saying that God can bring good from this?"

I suppose only the perspective that time brings will give clarity to those thoughts. For now, it's enough for me to think like this: God, as the creator of life, does no wrong when he takes a life. From his perspective, life is never really destroyed, only changed. In changing life and circumstances on our level, God is inevitably working towards our best interests, even if that is unclear to us.

That's about it, for now. If you feel like disagreeing with me, feel free to. Or call me a monster for thinking such thoughts two days after the shootings. Either way, the comments are open.

Lost in Translation

Statement: "Hey, have you lost weight?"

Interpretation: "You're not as fat as I remember."

How I Argue With Atheists

Super Paper Mario (P)review

I picked up Super Paper Mario for the Wii today. It was only released on Tuesday, so this review is a bit more applicable.

The Paper Mario series is a set of very fun, very family-friendly games that Nintendo released. In these games, Mario is 2D, and that aspect comes into play when Mario must roll up into a tube to slide into small spaces, fold himself into a paper-airplane to navigate chasms, and so forth. Lots of fun, and the graphics reflect the "paper" theme, which makes it pretty cute without being overbearing.

I never played the first one, released on the N64. The Gamecube release, The Thousand Year Door, was an action/RPG of great fun (if you haven't played it, go get it!)

This installment in the series leaves behind the best of the RPG elements, which is a real shame. The game is 95% platformer now, with about 5% RPG still involved (finding items, growing stronger by gaining experience). It's still a fun platformer, but I miss the turn-based battles where the timing of button-pressing affected damage (etc.)

Well, this shouldn't be a review of the game I wanted. The game plays like the old NES Mario games, but with a twist; when you press the right button, the world swings around and you now have a 3D view. Can't get past a group of Thwomps or a tall pipe? Rotate the world and just walk around. It's a pretty clever idea, although it does get a little disorienting to do it so often. The game also puts a timer on you, where staying in the "rotated" mode for too long results in damage to your character. This seems like an unnecessary feature, given how integral the swapping of views is to play the game.

I only played through the first level (~2hrs of play), so these are only initial thoughts. The spirit of the game is true to the series, and it's been fun. Pick it up if you can find a copy (but I'd recommend the last installment over this one).

Final Fantasy III Review

I'm a little late on the draw here, both because the game has been released for a while, and because the DS version is a re-release of a game that was in Japan in 1990. Still, it's what I've been playing, so I thought I'd share my thoughts on it.

This game, like every other Final Fantasy game, is an RPG (in the Japanese sense). That is, you're handed characters and guided through the story, but you get to run through the battles. Well, "story" is a bit generous. The first three Final Fantasy games were essentially about the battle system, finding cool spells and powerful equipment . . . basically like World of Warcraft, except with older graphics and no social interaction (if that's what you'd call what you get in WoW). The stories were just short segments of text inbetween quests to help you advance to the next part of the game. Even in that, it's pretty standard FF fair: Chosen heroes, find the crystals, stop the bad guy, save the world, blah blah blah.

So, the story's nothing to write home about, but the updated graphics look nice on the DS, and the battle system is pretty fun. In FFI, the only one released on the NES in America, you chose a character class for your party of four in the beginning of the game and that is how you played the game. In FFIII, you get to change your character class whenever you want. All stats will change to levels appropriate for that class when you switch, so there's very little downside to using whatever classes you want. This gives a lot of flexibility to the player and a lot of replayability to the game, since there are 23 different classes altogether.

The downsides to this system are the times when choices are distinctly narrowed for you, and the lack of equipment for some classes. Certain parts of the game put you in the position of choosing classes because those are the only ones that stand a chance of surviving the encounters. I suppose you could praise the game for forcing you to step outside your comfort zones, but I see it as taking away some of the choice you should have in playing the game.

Then there are times where a character might seem useful, but his equipment is so old, or in short supply, that he's worthless anyhow. An example is the Scholar. This class's most useful ability is that item effects are doubled. This makes attack items incredibly potent in a Scholar's hands. However, those attack items are few and far between, and do only elemental damage. As the game gets further along, most enemies will have no elemental weaknesses (and some elemental resistances), so the Scholar loses his advantages.

Still, that doesn't handicap the game too much. It's still fun, and there's still plenty of room to explore the game's variety. If you are a Final Fantasy fan, pick this one up. It'll keep you entertained.

All The News That's Fit To Print

Slublog has an excellent point over at his blog:

Think about how much coverage the non-rape in Duke received. Imagine the amount of coverage this story would have gotten if the races had been reversed - if it had been a young African-American couple who were kidnapped, raped, tortured and murdered by four white men.

We'd never hear the end of it.

It's no secret that America has a problem with race. That problem is not helped when the media intently focuses on race in one crime, but completely ignores it in another. There are times when race is central to a crime, but viewing all crime through the prism of race is not always appropriate.

I hate to say it, though, but part of the reason this sells is it's "titillating." It's the kind of "man bites dog" story the media loves and our culture loves, too. It's an opportunity for the race-baiters and the PC-blabbermouths to cry from the roof tops about the evils of white men and so forth.

Take this an as example: The next time a white, non-Islamic person attempts to commit an act of terrorism in the US, watch the media reaction. I guarantee you'll see much of the same type of coverage as you did with the Duke case.

Dino DNA and Grad School

That's what this post is about. Gracious, it seems all I do anymore is whine about how grad school is keeping me busy, but there it is. Top it off with the lovely sinus infection I seem to have picked up, and you've found a conveniently timed combination.

In any event, I learned something cool in one of my classes this week. When Michael Crichton wrote Jurassic Park, he included a gene sequence for a segment of DNA which was supposedly part of the dinosaurs' genetic code when the scientists cloned them. One of the guys over at NCBI took the sequence and ran it through their search programs and discovered that the sequence was just junk; genetic code associated with cloning vectors. For you non-scientists out there, it's like getting bits of eggshell in the bowl when you crack an egg open.

The guy who discovered this wrote Crichton about it and provided him with a sequence for The Lost World that made a bit more sense. It was a sequence for a gene that encodes a transcription factor in chickens. Well, almost. If you translate that gene sequence, it matches the chicken gene letter for letter, except for several intervening amino acids that don't fit quite right. The amino acids end up spelling out words, though: MIKE WAS HERE NIH.

So this guy, in the most scientifically nerdy way possible, preserved his name and know-how in perpetuity amongst popular culture.

Neat.

Update
For those of you so-minded, here are the sequences in question, so you can see it for yourself.

The Jurassic Park DNA:

GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC TGCTCACGCTGTACCTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT

And the Lost World DNA:

GAATTCCGGAAGCGAGCAAGAGATAAGTCCTGGCATCAGATACAGTTGGAGATAAGGACG GACGTGTGGCAGCTCCCGCAGAGGATTCACTGGAAGTGCATTACCTATCCCATGGGAGCC ATGGAGTTCGTGGCGCTGGGGGGGCCGGATGCGGGCTCCCCCACTCCGTTCCCTGATGAA GCCGGAGCCTTCCTGGGGCTGGGGGGGGGCGAGAGGACGGAGGCGGGGGGGCTGCTGGCC TCCTACCCCCCCTCAGGCCGCGTGTCCCTGGTGCCGTGGGCAGACACGGGTACTTTGGGG ACCCCCCAGTGGGTGCCGCCCGCCACCCAAATGGAGCCCCCCCACTACCTGGAGCTGCTG CAACCCCCCCGGGGCAGCCCCCCCCATCCCTCCTCCGGGCCCCTACTGCCACTCAGCAGC GGGCCCCCACCCTGCGAGGCCCGTGAGTGCGTCATGGCCAGGAAGAACTGCGGAGCGACG GCAACGCCGCTGTGGCGCCGGGACGGCACCGGGCATTACCTGTGCAACTGGGCCTCAGCC TGCGGGCTCTACCACCGCCTCAACGGCCAGAACCGCCCGCTCATCCGCCCCAAAAAGCGC CTGCTGGTGAGTAAGCGCGCAGGCACAGTGTGCAGCCACGAGCGTGAAAACTGCCAGACA TCCACCACCACTCTGTGGCGTCGCAGCCCCATGGGGGACCCCGTCTGCAACAACATTCAC GCCTGCGGCCTCTACTACAAACTGCACCAAGTGAACCGCCCCCTCACGATGCGCAAAGAC GGAATCCAAACCCGAAACCGCAAAGTTTCCTCCAAGGGTAAAAAGCGGCGCCCCCCGGGG GGGGGAAACCCCTCCGCCACCGCGGGAGGGGGCGCTCCTATGGGGGGAGGGGGGGACCCC TCTATGCCCCCCCCGCCGCCCCCCCCGGCCGCCGCCCCCCCTCAAAGCGACGCTCTGTAC GCTCTCGGCCCCGTGGTCCTTTCGGGCCATTTTCTGCCCTTTGGAAACTCCGGAGGGTTT TTTGGGGGGGGGGCGGGGGGTTACACGGCCCCCCCGGGGCTGAGCCCGCAGATTTAAATA ATAACTCTGACGTGGGCAAGTGGGCCTTGCTGAGAAGACAGTGTAACATAATAATTTGCA CCTCGGCAATTGCAGAGGGTCGATCTCCACTTTGGACACAACAGGGCTACTCGGTAGGAC CAGATAAGCACTTTGCTCCCTGGACTGAAAAAGAAAGGATTTATCTGTTTGCTTCTTGCT GACAAATCCCTGTGAAAGGTAAAAGTCGGACACAGCAATCGATTATTTCTCGCCTGTGTG AAATTACTGTGAATATTGTAAATATATATATATATATATATATATCTGTATAGAACAGCC TCGGAGGCGGCATGGACCCAGCGTAGATCATGCTGGATTTGTACTGCCGGAATTC

Cheers.

Gore, Gray, and ABC

As a counter-balance to my previous post on global warming where I said I don't trust the traditional media to provide a balanced perspective on it, here's an ABC article about Dr. William Gray, a hurricane forecasting expert, taking Al Gore to task for his efforts.

I'll give ABC kudos for covering the other side of the debate, but the article is still worthless. I think Al Gore's efforts have made the debate worse by politicizing the science even further, with the result that a lot of people end up arguing about Al Gore rather than the actual science. Not that that's ABC's fault, but it has to be said.

The article doesn't really say much about Dr. Gray's remarks. It talks about him giving a speech in New Orleans, probably a very long one, but only mentions the tack against Gore. It mentions that he doesn't believe there's much to the global warming hype, but it's just a blurb (i.e. no science). And, of course, the last blurb of the article is an MIT professor (all we know about his/her credentials) saying that Dr. Gray is wrong about global warming.

So, Dr. Church is right that the sources behind these types of stories are probably doing good work. It's just that I don't trust the media to properly handle such stories when nearly useless articles like this are the result.

Pelosi's Shadow Presidency

If you remember, back in October I wondered whether or not talk of impeaching Bush and Cheney was political in the sense of trying to turn potential Speaker Nancy Pelosi into President Pelosi. Most of you disagreed with my hypothetical (not that I firmly believed it).

Turns out she isn't waiting for the impeachments.

Here's a Washington Post editorial criticizing Pelosi for attempting to establish a "shadow Presidency" based on both the recent "war appropriations"/peanut storage bill and her trip to Syria.

Hey, at least someone else out there thinks it's plausible.

(Hat tip: Ace)

Unstoppable Global Warming

In case you're tired of the quiet and need something to occupy your time until I pay more attention to this thing, I heard another interesting radio show from the Powerline guys. This time, they interviewed the author of a new book, Unstoppable Global Warming: Every 1500 Years.

It sounds like it's worth reading. Honestly, I don't know enough about the science to say, "Oh, this guy's full of it!" Where "this guy" is either the book's author, Al Gore, etc. Take your pick. However, given the level at which I trust the major media outlets to present the issue (or any other science story) intelligently, a little outside reading wouldn't hurt.

If you decide to read it, let me know what you think.